circad | circRNAs associated with diseases

Circular RNA DOCK1
Gene	DOCK1	Organism	Human
Genome Locus	chr10:128768965-128860040:+	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30983072
Experimental Method
Sample Type	Tissue and cell lines	Comparison	23 BC tissue specimens and 32 normal bladder tissue specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTCTTCAGGTCCATCAATGAC Reverse CGATCTGTAAAGAAAGTTCATCCG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, P, Li, X, Guo, X, Chen, J, Li, C, Chen, M, Liu, L, Zhang, X, Zu, X (2019). Circular RNA DOCK1 promotes bladder carcinoma progression via modulating circDOCK1/hsa-miR-132-3p/Sox5 signalling pathway. Cell Prolif., 52, 4:e12614.